View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_high_84 (Length: 206)
Name: NF10602_high_84
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_high_84 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 32286744 - 32286566
Alignment:
| Q |
19 |
ccattcccgatcgtgaagaacaccgctggctccgcgaagaacaacgatggcttcgcgaggagcaacggtggattcgtgaggagaatcgatggaaccgtga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32286744 |
ccattcccgatcgtgaagaacaccgctggctccgcgaagaacaacgatggcttcgcgaggagcaacggtggattcgtgaggagaatcgatggaaccgtga |
32286645 |
T |
 |
| Q |
119 |
acgggctgagcttctcagagagatttctgaacttaaacttcaaattcaatctctcgagcaccgaattctatcttcatct |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32286644 |
acgggctgagcttctcagagagatttctgaacttaaacttcaaattcaatctctcgagcaccgaattctatcttcatct |
32286566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University