View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_104 (Length: 224)
Name: NF10602_low_104
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_104 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 34292101 - 34291905
Alignment:
| Q |
17 |
agaaaagaggttgtgttagaagaacgtccggtagattgaagaagtgcttggaaatgattctgttatgttgtttgtttaatttctttatttaccttttcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34292101 |
agaaaagaggttgtgttagaagaacgtccggtagattgaagaagtgcttggaaaagattctgttatgttgtttgtttaatttctttatttactttttcaa |
34292002 |
T |
|
| Q |
117 |
ttaagattgtgcaactaaatatacacaaaaaataaaaggtagctttatgtacaatgtggtatagattaatcatcttaatcaaccgtatcctatgcta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34292001 |
ttaagattgtgcaactaaatatacacaaaaaataaaaggtagctttatgtacaatgtggtatagattaatcatcttaatcaaccgtatcttatgcta |
34291905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University