View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10602_low_106 (Length: 221)

Name: NF10602_low_106
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10602_low_106
NF10602_low_106
[»] chr1 (1 HSPs)
chr1 (71-206)||(18922389-18922523)


Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 71 - 206
Target Start/End: Complemental strand, 18922523 - 18922389
Alignment:
71 tatgcttcttaatattgaatcacaacaaataagcaaaaatttcccagactgaagcacaccaccagaaggcaacactttccactgtccaaaatccaaacca 170  Q
    ||||||||| ||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
18922523 tatgcttctaaatattgaatcgcaacaaataagcaaaaatttccaagagtgaagcacaccaccagaaggcaacactttccactgtccaaaatccaaacca 18922424  T
171 tgatcatcgaacattgggaagagctagcaacaaaat 206  Q
    |||| || ||||||||||||||||||||||||||||    
18922423 tgat-atggaacattgggaagagctagcaacaaaat 18922389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University