View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_106 (Length: 221)
Name: NF10602_low_106
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_106 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 71 - 206
Target Start/End: Complemental strand, 18922523 - 18922389
Alignment:
| Q |
71 |
tatgcttcttaatattgaatcacaacaaataagcaaaaatttcccagactgaagcacaccaccagaaggcaacactttccactgtccaaaatccaaacca |
170 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18922523 |
tatgcttctaaatattgaatcgcaacaaataagcaaaaatttccaagagtgaagcacaccaccagaaggcaacactttccactgtccaaaatccaaacca |
18922424 |
T |
 |
| Q |
171 |
tgatcatcgaacattgggaagagctagcaacaaaat |
206 |
Q |
| |
|
|||| || |||||||||||||||||||||||||||| |
|
|
| T |
18922423 |
tgat-atggaacattgggaagagctagcaacaaaat |
18922389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University