View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_108 (Length: 219)
Name: NF10602_low_108
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_108 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 2 - 197
Target Start/End: Complemental strand, 494707 - 494526
Alignment:
| Q |
2 |
aaaaatacatgtgaaatttcagtctccgctaggcctctactacatccactatatttctaatagtacattcttccataagaaatgaagcatggattatgat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | | ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
494707 |
aaaaatacatgtgaaatttcagtctccgctaggcctctacta-----------tgtttaata---cattcttccataagaaatgaagcatggattatgat |
494622 |
T |
 |
| Q |
102 |
atgtaatactaatattttttcagtccacttgtttttgatgatatggtatcatgaacagctgagttggataaaaataaatttgtcattaatcaatac |
197 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
494621 |
atgtaattctaatattttttcagtccacttgtttttgatgatatggtatcatgaacagctgagttggataaaaacaaatttgtcattaatcaatac |
494526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University