View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_112 (Length: 215)
Name: NF10602_low_112
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_112 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 11 - 198
Target Start/End: Original strand, 33710454 - 33710641
Alignment:
| Q |
11 |
gcagagatcaaagaaactataccaactaccaaactcaatgcagaaccaattaacacaaacagaattcccattgcacaagttaacaatggactcaaccaaa |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33710454 |
gcagaaatcaaagaaactataccaactaccaaactcaatgcagaaccaattaacacaaacagaattcccattgcacacgttaacaatggactcaaccaaa |
33710553 |
T |
|
| Q |
111 |
atgctgccctgagcgccttttccgggtggcttgcaatgatccattgccacatcaaaccaagaattcctccacatactgttgatgctag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33710554 |
atgctgccctgagcgccttttccgggtggcttgcaatgatccattgccacatcaaaccaagaattcctccacatactgttgatgctag |
33710641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University