View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_119 (Length: 203)
Name: NF10602_low_119
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_119 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 27053417 - 27053603
Alignment:
| Q |
1 |
tttgatcaaaatggaacggggcaaaaacgacctaggtggtaacttatcccttatatctggcataggcataacagtcccttccttcaacatcgtttcgcgg |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27053417 |
tttgatcaaaatggaacgtggcaaaaacgacctaggtggtaacttatcccttgtatctggcataggcataacagtcccttccttcaacatcctttcgcgg |
27053516 |
T |
|
| Q |
101 |
aaaaacttacctggttcaaccaccaaactggtaacggagttagttgaagaagatttagtgtagatgccgaatgaaatacctcttttg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27053517 |
aaaaacttacctggttcaaccaccaaactggtaacggagttagttgaagaagatttagtgtagatgccgaatgaaatacctcttttg |
27053603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 27065859 - 27065980
Alignment:
| Q |
1 |
tttgatcaaaatggaacggggcaaaaacgacctaggtggtaacttatcccttatatctggcataggcataacagtcccttccttcaacatcgtttcgcgg |
100 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||| || ||||| ||||||||||||||||||||||||||||| |||||||||||||||||| | || ||| |
|
|
| T |
27065859 |
tttggtcaaaatggaacgaggcaaaaacgaccttggcggtaatttatcccttatatctggcataggcataactgtcccttccttcaacatcttctcccgg |
27065958 |
T |
|
| Q |
101 |
aaaaacttacctggttcaacca |
122 |
Q |
| |
|
||||||||||| |||| ||||| |
|
|
| T |
27065959 |
aaaaacttaccaggttgaacca |
27065980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 27079576 - 27079696
Alignment:
| Q |
1 |
tttgatcaaaatggaacggggcaaaaacgacctaggtggtaacttatcccttatatctggcataggcataacagtcccttccttcaacatcgtttcgcgg |
100 |
Q |
| |
|
|||| ||||||||| ||| || ||||||||||| || ||||| |||||| | ||||| |||||||||||||| ||||| ||||||||| |||| ||| |
|
|
| T |
27079576 |
tttggtcaaaatggtacgtggtaaaaacgaccttggcggtaatttatccttaatatccggcataggcataaccaccccttgtttcaacatcttttctcgg |
27079675 |
T |
|
| Q |
101 |
aaaaacttacctggttcaacc |
121 |
Q |
| |
|
||||||||||| |||| |||| |
|
|
| T |
27079676 |
aaaaacttaccaggttgaacc |
27079696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University