View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_17 (Length: 346)
Name: NF10602_low_17
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 8 - 179
Target Start/End: Original strand, 35197678 - 35197849
Alignment:
| Q |
8 |
aagcagagataattgcatcagcgaagcaacgtgtttactggttcataccttcgttgatttcaaactcttcaaattcatcatcgtcttcgaatagatcgat |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35197678 |
aagcaaagataattgcatcagcgaagcaacgtgtttactggttcataccttcgttgatttcaaactcttcaaattcatcatcgtcttcgaatagatcgat |
35197777 |
T |
|
| Q |
108 |
cttgacatcctcggtcacggcctttgcttcagttgccatagataaatctgaatctgcagttaattcgaaccc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35197778 |
cttgacatcctcggtcacggcctttgcttcagttgccatagataaatctgaatctgcagttaattcgaaccc |
35197849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 219 - 331
Target Start/End: Original strand, 35197888 - 35198000
Alignment:
| Q |
219 |
ccctaattttgataaaggggaatagggtttgaatcaaattaaactttaaaatatttcgtagaacaaatgattggaatgaaggaacaaagtaattacctgg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35197888 |
ccctaattttgataaaggggaatagggtttgaatcaaattaaactttaaaatatttcgtagaacaaatgattggaatgaaggaacaaagtaattacctgg |
35197987 |
T |
|
| Q |
319 |
tattggttgaatt |
331 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35197988 |
tattggttgaatt |
35198000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University