View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_32 (Length: 303)
Name: NF10602_low_32
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 101 - 295
Target Start/End: Original strand, 2177229 - 2177423
Alignment:
| Q |
101 |
tatggacatagaagagtgaatttatagtagttgattatgaagtatatgatatgatataaggataagcatatgatcgatatgtctagggtggcggggcaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2177229 |
tatggacatagaagagtgaatttatagtagttgattatgaagtatatgatatgatataaggataagcatatgatcgatatgtctagggtggcggggcaca |
2177328 |
T |
|
| Q |
201 |
aagggtcatggactaattacctgaannnnnnnctgctcaatatcaatgaagtgacctaggggtcaaggaagagaaaagtcatacatgtctctgct |
295 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2177329 |
aagggtcatggactaattacctgaatttttttctgctcaatatcaatgaagtgacctaggggtcaaggaagagaaaagtcatacatgtctttgct |
2177423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 2177130 - 2177173
Alignment:
| Q |
1 |
tcaagacaatcaaacaatatggtagtgatcatggttttatgttt |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2177130 |
tcaagacaatcaaacaatatggtagtgatcatggttttatgttt |
2177173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University