View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_50 (Length: 262)
Name: NF10602_low_50
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 251
Target Start/End: Original strand, 41978418 - 41978653
Alignment:
| Q |
16 |
caagattcaccgctatctcccggaaagtatacaaaatccaattcaaagaaaaatatgggaagtctcgatgatgttaggtctaatggttggttggatgcta |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41978418 |
caagattcaccgctatctcccgggaagtatacaaaatccaattcaaagaaaaatatgggaagtctcgatgatgttaggtctaatggttggttggatgcta |
41978517 |
T |
|
| Q |
116 |
tgaaggcatcttcgcctccaaggaagaaattggtactcaaaggttcgagcgctcaggttgcttcaattgactttgacatggaagattataatttatggat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41978518 |
tgaaggcatcttcgcctccaaggaagaaatcggtactcaaaggttcgagcgctctggttgcttcaattgactttgacatggaagattataatttatggat |
41978617 |
T |
|
| Q |
216 |
ggtatggtttatttctactaattaatttctgcctat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41978618 |
ggtatggtttatttctactaattaatttctgcctat |
41978653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University