View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_52 (Length: 259)
Name: NF10602_low_52
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 6984468 - 6984232
Alignment:
| Q |
17 |
aagtgtcactctcgatataaacacttttcagaccttatgtctttttaatgtgaaacttggacnnnnnnnnaattgatattgtggaaaatctgggccaagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6984468 |
aagtgtcactctcgatataaacacttttcagaccttatgtctttttaatgtgaaacttggacttttttgtaattgatattgtggaaaatctgggccaagt |
6984369 |
T |
|
| Q |
117 |
acagttaatgtggtgcagatagtgtgcacattgtggtcgtagaggcataaaaatcatgatgtcgcaacccagatggcgatagtggacnnnnnnnnnnnaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
6984368 |
acagttaatgtggtgcagatagtgtgcacattgtggtcgtagaggcatgaaaatcatgatgtcgcaacccagatggtgatagtggactttttttttttaa |
6984269 |
T |
|
| Q |
217 |
atcttgcatgtccttgtaaactgaaattctctgctcc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6984268 |
atcttgcatgtccttgtaaactgaaattctttgctcc |
6984232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University