View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_61 (Length: 251)
Name: NF10602_low_61
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 11573702 - 11573464
Alignment:
| Q |
1 |
tatcattctttaaagtttatattttaacattgtttgtatttattcaattgcaaaattnnnnnnnnncttacattgcatgcccgtttaactttccttgcat |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11573702 |
tatcattctttaaagtatatattttaacattgtttgtatttattcaactgcaaaattaaaaaaaa-cttacattgcatgcccgtttaactttccttgcat |
11573604 |
T |
 |
| Q |
101 |
aattacattttt-ctcttttgttacttagataaaatgataataaccattgaaaatttaccgcataagtggaggagacacggttcaaacatcaattgggac |
199 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11573603 |
aattacattttttctcttttgttacatagataaaatgataataaccattgaaaatttactgcataagtggaggagacacgtttcaaacatcaattgggac |
11573504 |
T |
 |
| Q |
200 |
atccgacctaacaattttcttatttttgtcagttggccta |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11573503 |
atccgacctaacaattttcttatttttgtcagttggccta |
11573464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 164
Target Start/End: Complemental strand, 3509580 - 3509532
Alignment:
| Q |
116 |
ttttgttacttagataaaatgataataaccattgaaaatttaccgcata |
164 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||| ||| |||| |
|
|
| T |
3509580 |
ttttgttagatagataaaatgataatagccattgaaaattcaccacata |
3509532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University