View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_63 (Length: 250)
Name: NF10602_low_63
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 2 - 237
Target Start/End: Complemental strand, 6984021 - 6983786
Alignment:
| Q |
2 |
tttatattgtgattttttgtcatgttttaatgttaagatatgatgcaagaattagtaatgtcgcttattgcactgaattttgtgatttgaagtggactta |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
6984021 |
tttatattgtgattttttgtcatgttttaatgttaagatatgatgcaagaattagtaatgtcgcttattgcactgaatattgtgacttgaagtggactta |
6983922 |
T |
 |
| Q |
102 |
attatcttctgtttcagcatctatagccatatttgtgtgaacctctttctcttttttcactgcataggtagaaggaagagttgaagacaatggttaagtc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6983921 |
attatcttctgtttcagcatctatagccatatttgtgtgaacctctttctcttttttcactgcgtaggtagaaggaagagttgaagacaatggttaagtc |
6983822 |
T |
 |
| Q |
202 |
tactgctaaggatgcacaagatcttatccgcactct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6983821 |
tactgctaaggatgcacaagatcttatccgcactct |
6983786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University