View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_66 (Length: 247)
Name: NF10602_low_66
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_66 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 4 - 233
Target Start/End: Original strand, 41804230 - 41804459
Alignment:
| Q |
4 |
cagaagttttgaagagggaaccacttgctgaatttattaaggatttctacattcaataccaatttctttacgcacaatataaagagcaagcaagggtcaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41804230 |
cagaagttttgaagagggaaccacttgctgaatttattaaggatttctacattcaataccaatttctttacgcacaatatgaagagcaagcaagggtcaa |
41804329 |
T |
|
| Q |
104 |
cattgaagagatcagtgatttgacacagcagaagttagagttacatgatagaaatgttgacttnnnnnnnngatcagctgatagagaattggccttatca |
203 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41804330 |
cattgaagagatcagtgctttaacacagcagaagttagagttacatgatagaaatgttgacttaaaaaaaagatcagctgatagagaattggccttatca |
41804429 |
T |
|
| Q |
204 |
tgtatccgtgaatttaataagtccctcctg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41804430 |
tgtatccgtgaatttaataagtccctcctg |
41804459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 3 - 80
Target Start/End: Original strand, 41795821 - 41795898
Alignment:
| Q |
3 |
gcagaagttttgaagagggaaccacttgctgaatttattaaggatttctacattcaataccaatttctttacgcacaa |
80 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||| ||||| || ||| |||||||||||| ||||| ||||| |
|
|
| T |
41795821 |
gcagaacttttgaagagggaaccacttgctgaattgattgaggatatccacaatcaataccaattgatttacacacaa |
41795898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University