View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_72 (Length: 241)
Name: NF10602_low_72
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_72 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 43169942 - 43170162
Alignment:
| Q |
18 |
gatttaaactgattaagtagtacttggatattatgtctctatcttggaaagacttgacttataatgtccctgctaagatctattggtagggtattattgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43169942 |
gatttaaactgattaagtagtacttggatattatgtctctatcttggaaagacttgacttataatgtccctgctaagatctattggtagggtataattgt |
43170041 |
T |
 |
| Q |
118 |
cgatgaaagataaatccaaacccacattttttgtatagttgaaaatgtaactataagtccc-taaaaatcaaaatggtagggtcagtacattgattttgt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43170042 |
cgatgaaagataaatccaaacccacattttttgtatagttgaaaatgcaactataagtcccttaaaaatcaaaatggtagggtcagtacattgattttgt |
43170141 |
T |
 |
| Q |
217 |
taggcttcttataaagacttt |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43170142 |
taggcttcttataaagacttt |
43170162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University