View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_77 (Length: 241)
Name: NF10602_low_77
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_77 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 5e-71; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 79 - 222
Target Start/End: Complemental strand, 31797624 - 31797481
Alignment:
| Q |
79 |
aaactttatatagaaatgcatgagcagggggccaatatatgaaatagtatatactttgcaagtataggcttgcttgggattcctggaaccattgataaac |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31797624 |
aaactttatatagaaatgcatgagcagggggccaatatatgaaatagtatatactttgcaagtataggcttgcttgggattcctcgaaccattgataaac |
31797525 |
T |
 |
| Q |
179 |
ttgaaactgaaaactcaatgcctttgttcatgtgagagctggga |
222 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31797524 |
ttgaaactgaaaactcaatgcttttgttcatgtgagagctggga |
31797481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 107 - 210
Target Start/End: Complemental strand, 31786209 - 31786106
Alignment:
| Q |
107 |
gggccaatatatgaaatagtatatactttgcaagtataggcttgcttgggattcctggaaccattgataaacttgaaactgaaaactcaatgcctttgtt |
206 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31786209 |
gggcctatatatgaaatagtatatactttgcaagcataggcttgattgggattcctggaaccattgataaacttgaaactgaaaactcaatgcctttgtt |
31786110 |
T |
 |
| Q |
207 |
catg |
210 |
Q |
| |
|
|||| |
|
|
| T |
31786109 |
catg |
31786106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 31786807 - 31786701
Alignment:
| Q |
1 |
tatttttattttcattcatctcatagtatcttg-tgattaaaaaatcagcctaaaaagcttttagtatgtattttaataaaactttatatagaaatgcat |
99 |
Q |
| |
|
|||| ||||| | |||||||||| ||||||| ||||||||||||||| |||||| | |||| |||| |||| |||||||| |||| |||||||| | |
|
|
| T |
31786807 |
tattattattattattcatctcactatatcttgatgattaaaaaatcagtctaaaatgtgtttaccatgtgttttgataaaactctatagagaaatgcct |
31786708 |
T |
 |
| Q |
100 |
gagcagg |
106 |
Q |
| |
|
||||||| |
|
|
| T |
31786707 |
gagcagg |
31786701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University