View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_78 (Length: 240)
Name: NF10602_low_78
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_78 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 12 - 165
Target Start/End: Complemental strand, 18097440 - 18097287
Alignment:
| Q |
12 |
gaagcagagatcactaagaaacgaatatgatgaactgaagctacttctcacccatgaaactgccatggacgattagtagatgatgacattgacagaggag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18097440 |
gaagcagagatcactaagaaacgaatatgatgaactgaagctacttctcacccatgaaactgccatggacgattagtagatgatgacattgacagaggag |
18097341 |
T |
 |
| Q |
112 |
gagtaaaagggtttcagtaaattgtgnnnnnnnnattgtagtgataatttaatt |
165 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18097340 |
gagtaaaagggtttcagtaaattgtgttttttttattgtagtgataatttaatt |
18097287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 218
Target Start/End: Complemental strand, 18097268 - 18097232
Alignment:
| Q |
182 |
gagagaaggtaatttaattaatattaatataaaacaa |
218 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18097268 |
gagagaaggtaatttaatcaatattaatataaaacaa |
18097232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University