View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_80 (Length: 239)
Name: NF10602_low_80
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_80 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 33163981 - 33164205
Alignment:
| Q |
1 |
taccctttagtctttactacggttcatcaaagattaacctaagtgcgccgatatgatttatacttcatgacttaattaatatccttaatttttctagtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33163981 |
taccctttagtctttactacggttcatcaaagattaacctaagtgcgccgatatgatttatacttcatgacttaattaatatccttaatttttcttgtga |
33164080 |
T |
|
| Q |
101 |
attgatattgctactttataaaatcaacttggatttcttgattttgctgaattacannnnnnnnctttcagttcgcaaggcttattatgaagcagtgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33164081 |
attgatattgctactttataaaatcaacttggattttttgattttgctaaattacattttttttctttcagttcgcaaggcttattctgaagcagtgaaa |
33164180 |
T |
|
| Q |
201 |
agagctattttggatcatcatactg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33164181 |
agagctattttggatcatcatactg |
33164205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University