View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_81 (Length: 239)
Name: NF10602_low_81
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_81 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 43 - 224
Target Start/End: Original strand, 47419736 - 47419923
Alignment:
| Q |
43 |
aacaaaaatgatgtaaaacaaagatattctgtcaagatgaactcacgtgtggtctggtcttgctctgt------gactgtgggcaatgcaagcaaagtag |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47419736 |
aacaaaaatgatgtaaaacaaagatattctgtcaagatgaactcacgtgtggtctggtcttgctctgtgactgtgactgtgggcaatgcaagcaaagtag |
47419835 |
T |
 |
| Q |
137 |
aagagggtaaaagaggttgcacgtggtggtgactgccatggtgatatgttaagattcccatccttaaaatcactggccccactctctg |
224 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47419836 |
aagagggtaaaagagcttgcacgtggtggtgactgccatggtgatatgtgaagattcccatccttaaaatcactggccccactctctg |
47419923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University