View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_83 (Length: 239)
Name: NF10602_low_83
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_83 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 26217382 - 26217609
Alignment:
| Q |
1 |
tgtaatgtgctctataaagttgtggttaaagtattagccaacatgttgaaagtgtacttgataagtgtatatacaaaaatcaatcagcttttgtgtcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26217382 |
tgtaatgtgctctataaagttgtggttaaagtattagccaacatgttgaaagtgtacttgataagtgtatatacaaaaatcaatcagcttttgtgtcaag |
26217481 |
T |
 |
| Q |
101 |
ttactctattctcgataatgcaatgacaaccattgaaattgttcat-------------aggtgaaagttaatcaaggtaatgtagctcatagactttat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26217482 |
ttactctattctcgataatgcaatgacaaccattgaaattgttcatcgtgtgaaacctaaggtgaaagttaatcaaggtaatgtagctcatagactttat |
26217581 |
T |
 |
| Q |
188 |
attagtaaatcctatgataggctggatt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
26217582 |
attagtaaatcctatgataggttggatt |
26217609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University