View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_84 (Length: 239)
Name: NF10602_low_84
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_84 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 21878514 - 21878736
Alignment:
| Q |
1 |
tatgcttctttgatcatggaagagcttgatccagatcataatggatatatagaggtaattagaattagaagccgattaaattgtaacgacatatatcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21878514 |
tatgcttctttgatcatggaagagcttgatccagatcataatggatatatagaggtaattagaattagaagccgattaaattgtaacgacatatatcttc |
21878613 |
T |
|
| Q |
101 |
tgttcagaatgttttttaaatttacatctcttgaaaacagatgtggcagcttgaaactctattaagggaaatggttagtgcagaagatggcaaaccaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21878614 |
tgttcagaatgttttttaaatttacatctcttgaaaacagatgtggcagcttgaaactctattaagggaaatggttagtgcagaagatggcaaaccaaaa |
21878713 |
T |
|
| Q |
201 |
cttggtacaagaacacaaacttt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
21878714 |
cttggtacaagaacacaaacttt |
21878736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University