View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_85 (Length: 238)
Name: NF10602_low_85
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_85 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 25709671 - 25709467
Alignment:
| Q |
16 |
gagagaacttgttcaattttttggttaaagaacattctccaaattaaaataggttgtttaatnnnnnnnncaaatttaaaaggtttttactttcctctta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
25709671 |
gagagaacttgttcaattttttggttaaagaacattctccaaattaaaataggttgtttaataaaaaaa-caaatttaaaaggtttatactttcctctta |
25709573 |
T |
|
| Q |
116 |
gaannnnnnn-gaagaaattatttctcttaaaattaaaaattactagattagcaggcaaaatataatctccatgagccattttgatcacattagatctaa |
214 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
25709572 |
gaattttttttgaagaaattatttctcttaaaattaaaaattactagattagcaggcaaaatataatctccatgagccattctgaccacattagatctaa |
25709473 |
T |
|
| Q |
215 |
ttaacc |
220 |
Q |
| |
|
|||||| |
|
|
| T |
25709472 |
ttaacc |
25709467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University