View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_87 (Length: 237)
Name: NF10602_low_87
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_87 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 10551742 - 10551520
Alignment:
| Q |
1 |
acggagtatcttattcgagtcgtgtgagatactaaatatgaatatcaatatatagttcatttatatctatgattttaatctcttaaatttcaaaaagtct |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10551742 |
acggagtatcttattcgagtcgtgttggatactaaatatgaatatcaatatatagttcatttatatctacgattttaatctcttaaatttcaaaaagtct |
10551643 |
T |
 |
| Q |
101 |
aacgtattcaacctatgcatgtgggtctaaacttttataatgtaacaagtcatatacctgcagaaattgagttggtgatgtaatattgtttagatgaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10551642 |
aacgtattcaacctatgcatgtgggtctaaacttttataatgtaacaagtcatatacctgcagaaattgagttggtgatgaaatattgtttagatgaatt |
10551543 |
T |
 |
| Q |
201 |
ctcatttaacaatatacacatat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10551542 |
ctcatttaacaatatacacatat |
10551520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University