View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_88 (Length: 236)
Name: NF10602_low_88
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_88 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 14 - 214
Target Start/End: Original strand, 3081517 - 3081726
Alignment:
| Q |
14 |
ctccaaactcacaaacaaagccttaattaacacca----------cattggatcatttagtggatgaacagatcaccttattatatgcagaaggggccaa |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3081517 |
ctccaaactcacaaacaaagccttaattaacaccatattttagcacattggatcatttagtggatgaacagatcaccttattatatgcagaaggggccaa |
3081616 |
T |
|
| Q |
104 |
agcataagatgtttaaacacttattgtagacctcaaaaaagtataattttctaagatttttaggcctctaaacagaatttatttaatgggttttagacct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
3081617 |
agcataagatgtttaaacacttattgtagacctcaaaaaagtataattttctaagatttttaggcctcaaaacagaattta-ttaatgggttttagacct |
3081715 |
T |
|
| Q |
204 |
caaaacatata |
214 |
Q |
| |
|
||||||||||| |
|
|
| T |
3081716 |
caaaacatata |
3081726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University