View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_92 (Length: 232)
Name: NF10602_low_92
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_92 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 217
Target Start/End: Original strand, 25322902 - 25323104
Alignment:
| Q |
15 |
ataggcaacataatatttcaatgctagacaattataatcaaattgacttagggcactatgcatgtttggaccgacaatgggtttggtagtatcacggtat |
114 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25322902 |
ataggcaacataatagttcaatgctagacaattataatcaaattgacttagcgcactatgcatgtttggaccgacaatgggtttggtagtatcacggtat |
25323001 |
T |
|
| Q |
115 |
gccatcgtgcttttagcaaaaacaacgctccgaaacttcgacaaaatcatgacgtcacattgatttcgccaaattcaccgtcaatctaacacgcacttgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25323002 |
gccatcgtgcttttagcaaaaacaacgctccgaaacttcgacaaaatcatgacgtcacattgatttcgccaaattcaccgtcaatctaacacgcacttgg |
25323101 |
T |
|
| Q |
215 |
tga |
217 |
Q |
| |
|
||| |
|
|
| T |
25323102 |
tga |
25323104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 93
Target Start/End: Original strand, 25325637 - 25325691
Alignment:
| Q |
39 |
tagacaattataatcaaattgacttagggcactatgcatgtttggaccgacaatg |
93 |
Q |
| |
|
||||||| |||| ||||| ||| ||||||||||||||||||||||| | |||||| |
|
|
| T |
25325637 |
tagacaactatattcaaactgagttagggcactatgcatgtttggaacaacaatg |
25325691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University