View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10602_low_99 (Length: 226)
Name: NF10602_low_99
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10602_low_99 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 211
Target Start/End: Original strand, 48475281 - 48475319
Alignment:
| Q |
173 |
cttttaagcttcaagctcttgcaaccttacctatatttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48475281 |
cttttaagcttcaagctcttgcaaccttacctatatttt |
48475319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University