View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10604_7 (Length: 306)
Name: NF10604_7
Description: NF10604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10604_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 99 - 278
Target Start/End: Original strand, 11138292 - 11138460
Alignment:
| Q |
99 |
ttgatgatactgcaaactcaaactgtttgagttccagactcttcgtcgggaaacaagatagggctttcccccttggattttttgttcagtgcaaatagnn |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
11138292 |
ttgatgatactgcaaactcaaactgtttcagttccagactcttcgtcgggaaacaagatagggctttcccccttagattttttgttctgtgcaaatagtt |
11138391 |
T |
 |
| Q |
199 |
nnnnnnnnnnnnnnctttcacaaaatggcttaaatagtcattttgattcttatacgaaattatacaatataattctctat |
278 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11138392 |
tttt-----------tttccacaaatggcttaaatagtcattttgattcttatacgaaattatacaatataattctctat |
11138460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 11138200 - 11138275
Alignment:
| Q |
1 |
gtaattgagggcgccaaatgagaagtggaggaagaagagggtgttaggattnnnnnnnttctgcatgctgtcaaca |
76 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11138200 |
gtaattgagggcgagaaatgagaagtggaggaagaagagggtgttaggattggggggattctgcatgctgtcaaca |
11138275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University