View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10605_high_6 (Length: 221)

Name: NF10605_high_6
Description: NF10605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10605_high_6
NF10605_high_6
[»] chr4 (1 HSPs)
chr4 (1-221)||(42445746-42445966)


Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 42445966 - 42445746
Alignment:
1 gaaatttagttttgaattggtgttgttatccagggggaatggccatgccgctaggatgttcacgcctggtcctataatatccggtttcaatataccagga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
42445966 gaaatttagttttgaattggtgttgttatccagggggaatggccatgccgccaggatgttcacgcctggtcctataatatccggtttcaatataccagga 42445867  T
101 ctcggcaagttgggacctcttgaagagaatgatgcaacggatggcgctaaggagttcccgataatcgttcccttaaacgaaatggttgctgtcggtgaag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42445866 ctcggcaagttgggacctcttgaagagaatgatgcaacggatggcgctaaggagttcccgataatcgttcccttaaacgaaatggttgctgtcggtgaag 42445767  T
201 tggaatttatgtaggccttga 221  Q
    |||||||||||||||||||||    
42445766 tggaatttatgtaggccttga 42445746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University