View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10605_low_14 (Length: 238)
Name: NF10605_low_14
Description: NF10605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10605_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 26940900 - 26941106
Alignment:
| Q |
13 |
agagacaaaccagttttgtacacgattggattagataatgtggaattttccagctataacaagtgtacaagaacacatgttctgtagtgttactagtatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26940900 |
agagacaaaccagttttgtacacgattggattagataatgtggaattttccagctataacaagtgtacaagaacacatgttctgtagtgttactagtatc |
26940999 |
T |
|
| Q |
113 |
tttcccgtgaacctgaatgtcacttacaactctcacgtcaggtataagatacaacagattatggactggcggaatttacttaatttttggattctaaccg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26941000 |
tttcccgtgaacctgaatgtcacttacaactctcacgtcaggtataagatacaacagattatggactggcggaatttacttaatttttggattctaaccg |
26941099 |
T |
|
| Q |
213 |
tcctagt |
219 |
Q |
| |
|
||||||| |
|
|
| T |
26941100 |
tcctagt |
26941106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University