View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10605_low_15 (Length: 235)
Name: NF10605_low_15
Description: NF10605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10605_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 13303312 - 13303511
Alignment:
| Q |
19 |
agacacgtgttaaggttggtgttcatgtttgtaaccacctttctgctgtggatgagtttggggttcgaagaatcccaatgggtgaacatgaacttcaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13303312 |
agacacgtgttaaggttggtgttcatgtttgtaaccacctttctgctgtggatgagtttggggttcgaagaatcccaatgggtgaacatgaacttcaaat |
13303411 |
T |
|
| Q |
119 |
tggtgatctcaaacattctattttggttcaaattttggaccaaattaaacattaagtgtcaaataaattcgacatatacaaagaagatttacaatatttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
13303412 |
tggtgatctcaaacattctattttggttcaaactttggaccaaattaaacattaagtgtcaaaaaaatt-gacatatacaaaaaagttttacaatatttt |
13303510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University