View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10605_low_18 (Length: 220)
Name: NF10605_low_18
Description: NF10605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10605_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 206
Target Start/End: Complemental strand, 26513085 - 26512893
Alignment:
| Q |
14 |
cataggtatgatgatgggttggttgtgtttagggagatggttaatggagggtttagaccggataattatacgtatccgtgtgttcttaaggcttgttctt |
113 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||| |||||||||| |
|
|
| T |
26513085 |
cataggtatgatgatgggttgcttgtgtttagggagatggttaatggagggtttagacccgataattatacttacccgtgtgttcttaaagcttgttctt |
26512986 |
T |
 |
| Q |
114 |
gttcggaaaatttgagatatgggttgttgattcatggagatgtgttgaaggttgggttggattttaatttgtttgttgggaatggtcttattg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
26512985 |
gttcggaaaatttgagatatgggttgttgattcatggagatgtgttgaaggttgggttggattttaatttgtttgttgggaacggtctaattg |
26512893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University