View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10605_low_19 (Length: 219)

Name: NF10605_low_19
Description: NF10605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10605_low_19
NF10605_low_19
[»] chr1 (1 HSPs)
chr1 (10-201)||(44100820-44101011)


Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 10 - 201
Target Start/End: Complemental strand, 44101011 - 44100820
Alignment:
10 gaagcagagacttgtgctgcaatgtaggctggaacatgtgcccatggaaaatggcgaaatgccgcgaaggcaatggtgagtgatggattgagatgtgcac 109  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
44101011 gaagcagagacttgtgctgcaatgtaggctggaacatgtgcccagggaaaatggcgaaatgccgcgaaggcaatggtgagtgatggattgagatgagcac 44100912  T
110 ctgagatatgaccaattgagagaataatgaacatgaccgttaatccagcacaagctgcatttcccataagagtttctactccattgtatttg 201  Q
    ||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||    
44100911 ctgagatatgaccaattgagagaataatgaacatgactgtcagtccagcacaagctgcatttcccataagagtttctactccattgtatttg 44100820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University