View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10605_low_19 (Length: 219)
Name: NF10605_low_19
Description: NF10605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10605_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 10 - 201
Target Start/End: Complemental strand, 44101011 - 44100820
Alignment:
| Q |
10 |
gaagcagagacttgtgctgcaatgtaggctggaacatgtgcccatggaaaatggcgaaatgccgcgaaggcaatggtgagtgatggattgagatgtgcac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44101011 |
gaagcagagacttgtgctgcaatgtaggctggaacatgtgcccagggaaaatggcgaaatgccgcgaaggcaatggtgagtgatggattgagatgagcac |
44100912 |
T |
|
| Q |
110 |
ctgagatatgaccaattgagagaataatgaacatgaccgttaatccagcacaagctgcatttcccataagagtttctactccattgtatttg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44100911 |
ctgagatatgaccaattgagagaataatgaacatgactgtcagtccagcacaagctgcatttcccataagagtttctactccattgtatttg |
44100820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University