View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10605_low_8 (Length: 314)
Name: NF10605_low_8
Description: NF10605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10605_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 27 - 303
Target Start/End: Complemental strand, 21298893 - 21298617
Alignment:
| Q |
27 |
cactgatgcacaattccagaccctgttgatccaattgtctttgttgtgcaactgctagagacctgattaaagaatccaatgcccaaatggaaaaagacaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21298893 |
cactgatgcacaattccagaccctgttggaccaattgtctttgttgtgcaactgctagagacctgattaaagaatccaatgcccaaatggaaaaagacaa |
21298794 |
T |
|
| Q |
127 |
agctactgcttctcttaagcgaactcgttttgaagctcgtaaaaatgccaccaccctctctagatcacgagatgatgttcaaattgaaactttgattttc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21298793 |
agctactgcttctcttaagcgaactcgttttgaagctcgtaaaaatgtcaccaccctctctagatcacgagatgatgttgaaattgaaactttgattttc |
21298694 |
T |
|
| Q |
227 |
aataccgctgcaaacttcccgttccgcacaatcacttatcctcggatatctaccttcctaccttgctttgctactcc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21298693 |
aataccgctgcaaacttcccgttccgcacaatcacttatcctcggatatctaccttcctaccttgctttgctactcc |
21298617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University