View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10606_high_4 (Length: 255)
Name: NF10606_high_4
Description: NF10606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10606_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 1788548 - 1788329
Alignment:
| Q |
18 |
atttcatggaccaattggaatactaagatcttctagagtttctttagtaaaattcttccttccctttgaaatcaataaggcctcttctagtgttttgaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1788548 |
atttcatggaccaattggaatactaagatcttctagagtttctttagtaaaattcttccttccctttgaaatcaataaggcctcttctagtgttttgaca |
1788449 |
T |
 |
| Q |
118 |
acttgttccatggatggtctttgttggtcaagggatgtgcatgatagagccaattgaagtgtaaaatcaaatgcttcttcagaataatttccttcaagtc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1788448 |
acttgttccatggatggtctttgttggtcaagggatgtgcatgatagagccaattgaagtgtaaaatcaaatgcttcttcagaataatttccttcaagtc |
1788349 |
T |
 |
| Q |
218 |
taggatcagcaaattctgtg |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1788348 |
taggatcagcaaattctgtg |
1788329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University