View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10606_high_8 (Length: 221)

Name: NF10606_high_8
Description: NF10606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10606_high_8
NF10606_high_8
[»] chr7 (1 HSPs)
chr7 (24-205)||(33904415-33904596)


Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 24 - 205
Target Start/End: Complemental strand, 33904596 - 33904415
Alignment:
24 agtaaaatcacaggtttaacttcttagctatgcttgctacatcaaatagatgtgctcgattatgcgactaggacggctaaaccaacattttacctaacaa 123  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||    
33904596 agtaaaatcacaggtttaacttcttagctatgcttgctaaatcaaatagatgtgctcaattatgcgactaggacggttaaaccaacattttacctaacaa 33904497  T
124 atctgtctgtgctggatcttagtaattaattagtgttgcttcttcaaaccaaaatgcacataaatgaaatttaatgcctatg 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33904496 atctgtctgtgctggatcttagtaattaattagtgttgcttcttcaaaccaaaatgcacataaatgaaatttaatgcctatg 33904415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University