View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10606_high_8 (Length: 221)
Name: NF10606_high_8
Description: NF10606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10606_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 24 - 205
Target Start/End: Complemental strand, 33904596 - 33904415
Alignment:
| Q |
24 |
agtaaaatcacaggtttaacttcttagctatgcttgctacatcaaatagatgtgctcgattatgcgactaggacggctaaaccaacattttacctaacaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33904596 |
agtaaaatcacaggtttaacttcttagctatgcttgctaaatcaaatagatgtgctcaattatgcgactaggacggttaaaccaacattttacctaacaa |
33904497 |
T |
 |
| Q |
124 |
atctgtctgtgctggatcttagtaattaattagtgttgcttcttcaaaccaaaatgcacataaatgaaatttaatgcctatg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33904496 |
atctgtctgtgctggatcttagtaattaattagtgttgcttcttcaaaccaaaatgcacataaatgaaatttaatgcctatg |
33904415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University