View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10606_low_15 (Length: 227)
Name: NF10606_low_15
Description: NF10606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10606_low_15 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 54787061 - 54786835
Alignment:
| Q |
1 |
ttaatttgattcatctttcttgttgaacaagctttttcgggcactattagagaggcattgtcaggtgggagtggttcaacgttaatatcaaccttcattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54787061 |
ttaatttgattcatctttcttgttgaacaagctttttcgggcactattggagaggcattgtcaggtgggagtggttcaacgttaatatcaaccttcattc |
54786962 |
T |
|
| Q |
101 |
catggaagcaaaagcctctaccacatagaaagtaatatgtctttgcctctaatagttggaaaacatctcttcctcctctcgtgatgttgcttatgaagcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54786961 |
catggaagcaaaagcctctaccacatagaaagtaatatgtctttgcctctaagagttggaaaacatctcttcctcctctcgtgatgttgcttatgaagcc |
54786862 |
T |
|
| Q |
201 |
cttatcaacacatttctcataatttgt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
54786861 |
cttatcaacacatttctcataatttgt |
54786835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University