View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10607_high_10 (Length: 210)
Name: NF10607_high_10
Description: NF10607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10607_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 14 - 192
Target Start/End: Complemental strand, 31011305 - 31011127
Alignment:
| Q |
14 |
agatgaaggtttagaggatgcacatgccgaagtctcttcccaagatccctccagaagcatcacatcttaattcgaaagcctttaatcttgaagaattacc |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31011305 |
agatgaaggtttagaggatgaacatgccgaagtctcttcccaagatccctccagaagcatcacatcttaattcgaaagcctttaatcttgaagaattacc |
31011206 |
T |
 |
| Q |
114 |
cttgcaaatatttccatttatggatttactagctacaaaagaagattggtctatcatcgtgtctgtccatctaacagat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31011205 |
cttgcaaatatttccatttatggatttactagctacaaaagaagattggtctatcatcgtgtctgtccatctaacagat |
31011127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University