View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10607_high_7 (Length: 240)

Name: NF10607_high_7
Description: NF10607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10607_high_7
NF10607_high_7
[»] chr3 (1 HSPs)
chr3 (17-240)||(22913309-22913532)


Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 22913532 - 22913309
Alignment:
17 aagggaagctatactgtgaaagactttaaaatatgacgacaataacacatgaagatacaagaaaatccaatccatgagtgtgatcatcccctatgaaaaa 116  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22913532 aagggaagctatactgggaaagactttaaaatatgacgacaataacacatgaagatacaagaaaatccaatccatgagtgtgatcatcccctatgaaaaa 22913433  T
117 tgatttagtacccttttcctatttcaaattaaccctccagaatttttgggaaattcagttcaacttccatgctccgaccggctaacaccatgataagcac 216  Q
    ||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
22913432 tgatttaatacccttttcctatttcaaattaaccctccataatttttgggaaattcagtgcaacttccatgctccgaccggctaacaccatgataagcac 22913333  T
217 cgtatgagggtgctccatcttcac 240  Q
    || |||||||||||||||||||||    
22913332 cgcatgagggtgctccatcttcac 22913309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University