View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10607_low_7 (Length: 250)
Name: NF10607_low_7
Description: NF10607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10607_low_7 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 5028023 - 5027782
Alignment:
| Q |
11 |
aagaataccatctctttttatattctaccactagtaatagtttatttaatcgacaaaactactggtactagttttttgtattctaaaataaatagcaaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5028023 |
aagaataccatctctttttatattctaccactagtactagtttatttaatcgacaaaactactagtactagttttttgtattctaaaataaatagcaaat |
5027924 |
T |
 |
| Q |
111 |
attaaca--gnnnnnnntgtatggtcaaagggaccccttagttgactatcaacaatcaaatttcaaatccaaccacgaatttcctacatcaaccccaagc |
208 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5027923 |
attaacaaagaaaaaaatgtatggtcaaagggaccccttagttgattatcaacaatcaaattccaaatccaaccacgaatttcctacatcaaccccaagc |
5027824 |
T |
 |
| Q |
209 |
gagtacactatatcttccctgctccatcccgcacgcaataac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5027823 |
gagtacactatatcttccctgctccatcccgcacgcaataac |
5027782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University