View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10607_low_8 (Length: 242)
Name: NF10607_low_8
Description: NF10607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10607_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 61 - 99
Target Start/End: Complemental strand, 5027688 - 5027650
Alignment:
| Q |
61 |
cacccaccttccctcaacctccgcagcaccccatccata |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5027688 |
cacccaccttccctcaacctccgcagcaccccatccata |
5027650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University