View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10607_low_8 (Length: 242)

Name: NF10607_low_8
Description: NF10607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10607_low_8
NF10607_low_8
[»] chr5 (1 HSPs)
chr5 (61-99)||(5027650-5027688)


Alignment Details
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 61 - 99
Target Start/End: Complemental strand, 5027688 - 5027650
Alignment:
61 cacccaccttccctcaacctccgcagcaccccatccata 99  Q
    |||||||||||||||||||||||||||||||||||||||    
5027688 cacccaccttccctcaacctccgcagcaccccatccata 5027650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University