View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10607_low_9 (Length: 240)
Name: NF10607_low_9
Description: NF10607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10607_low_9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 22913532 - 22913309
Alignment:
| Q |
17 |
aagggaagctatactgtgaaagactttaaaatatgacgacaataacacatgaagatacaagaaaatccaatccatgagtgtgatcatcccctatgaaaaa |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22913532 |
aagggaagctatactgggaaagactttaaaatatgacgacaataacacatgaagatacaagaaaatccaatccatgagtgtgatcatcccctatgaaaaa |
22913433 |
T |
|
| Q |
117 |
tgatttagtacccttttcctatttcaaattaaccctccagaatttttgggaaattcagttcaacttccatgctccgaccggctaacaccatgataagcac |
216 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22913432 |
tgatttaatacccttttcctatttcaaattaaccctccataatttttgggaaattcagtgcaacttccatgctccgaccggctaacaccatgataagcac |
22913333 |
T |
|
| Q |
217 |
cgtatgagggtgctccatcttcac |
240 |
Q |
| |
|
|| ||||||||||||||||||||| |
|
|
| T |
22913332 |
cgcatgagggtgctccatcttcac |
22913309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University