View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10608_high_12 (Length: 234)

Name: NF10608_high_12
Description: NF10608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10608_high_12
NF10608_high_12
[»] chr1 (1 HSPs)
chr1 (1-234)||(50530152-50530385)


Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 50530385 - 50530152
Alignment:
1 ccctctcgctttgctcgtcgcggcttctccgtctccacttcttacgaagaaatgagccgcgttcgagctaggtccggtaacagcatgcgcaaaaccctcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||    
50530385 ccctctcgctttgctcgtcgcggcttctccgtctccacttcttacgaagaaatgagccgtgttcgagctaggtccggcaacagcatgcgcaaaagcctcc 50530286  T
101 gttggtttgacttagtcagctttggtatcggtggaatggtcggcgccggagtcttcgtcaccactggccacgctacccgtgttcacgctggcccttccgt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50530285 gttggtttgacttagtcagctttggtatcggtggaatggtcggcgccggagtcttcgtcaccactggccacgctacccgtgttcacgctggcccttccgt 50530186  T
201 tgttctatcttacgccattgccggtttctgtgct 234  Q
    ||||||||||||||||||||||||||||||||||    
50530185 tgttctatcttacgccattgccggtttctgtgct 50530152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University