View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10608_high_18 (Length: 208)
Name: NF10608_high_18
Description: NF10608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10608_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 38025296 - 38025493
Alignment:
| Q |
1 |
ttattcttcacatctttgtttctcagtgcatacccgatcagtattattannnnnnnnnn--ggtagtgagtgtgttatgatgatcagatggtagtacttt |
98 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38025296 |
ttattcttcatatctttgtttctcagtgcatacccgatcagtattttttttatttttttttggtagtgagtgtgttatgatgatcagatggtagtacttt |
38025395 |
T |
|
| Q |
99 |
aaattttctatcaacaaaaacttaccacatcttgattaatttgttcgtgataaatattcttgagctgagtgtttaaaagttaaaacagaactattgaa |
196 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38025396 |
aaatttgctatcaacaaaaacttaccacatcttgattaatttgttcgtgataaatatttttgagctgagtgtttaaaagttaaaacagaactattgaa |
38025493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 38032018 - 38032064
Alignment:
| Q |
1 |
ttattcttcacat--ctttgtttctcagtgcatacccgatcagtatt |
45 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
38032018 |
ttattcttcacatatctatgtttctcagtgcatacccgatcagtatt |
38032064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University