View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10608_high_9 (Length: 243)
Name: NF10608_high_9
Description: NF10608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10608_high_9 |
 | |
|
| [»] scaffold1808 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 40692713 - 40692570
Alignment:
| Q |
1 |
caagaggttaaatatgattgatgaagtctccgtgagcataactcagttgcagagacatacatattgttatatgcagaggctggggttcgaatccggacac |
100 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
40692713 |
caagaggttaaatatggttgatgaaatctccgtgaacataactcagttgcagagacatacatattgttatatgcagaggctgaggttcgaacccggacac |
40692614 |
T |
|
| Q |
101 |
gccgctttaaaaaaatatatggtttagaaaaaagagtagaagaa |
144 |
Q |
| |
|
||||||| ||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
40692613 |
gccgcttaaaaaaaatatacggtttaggaaaaagagtagaagaa |
40692570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 225
Target Start/End: Complemental strand, 40692544 - 40692491
Alignment:
| Q |
167 |
gtgagtaagtctctagcattatctatactactagtatagtatgatgtcactagaataac |
225 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40692544 |
gtgagtaagtctctagcattatcta-----ctagtatagtatgatgtcactagaataac |
40692491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 94
Target Start/End: Original strand, 10442878 - 10442946
Alignment:
| Q |
25 |
agtctccgtgagcataactcagttgcagagacatacatattgttatatgcagaggctggggttcgaatcc |
94 |
Q |
| |
|
|||| |||||||||||||||||||| | ||| ||| | ||||||||||| || || |||||||||||||| |
|
|
| T |
10442878 |
agtcaccgtgagcataactcagttg-atagagatatacattgttatatgtaggggttggggttcgaatcc |
10442946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1808 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold1808
Description:
Target: scaffold1808; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 930 - 881
Alignment:
| Q |
30 |
ccgtgagcataactcagttg-cagagacatacatattgttatatgcagaggc |
80 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
930 |
ccgtgagcataactcagttgtcagggacatac--attgttatatgcagaggc |
881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 91
Target Start/End: Complemental strand, 3461826 - 3461761
Alignment:
| Q |
25 |
agtctccgtgagcataactcagttg-cagagacatacatattgttatatgcagaggctggggttcgaa |
91 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||| | ||||||||||| || || ||||||||||| |
|
|
| T |
3461826 |
agtctccgtgagcataactcagttgacagggacatgc--attgttatatgtaggggttggggttcgaa |
3461761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University