View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10608_low_12 (Length: 253)
Name: NF10608_low_12
Description: NF10608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10608_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 218
Target Start/End: Complemental strand, 40693012 - 40692807
Alignment:
| Q |
13 |
caaagggtggggtagaggcaaggtatattcaagtatggtgtatttgcgtatactctgcgtataacctaaacttctgtgtactataaaataaatactatag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40693012 |
caaagggtggggtagaggcaaggtatattcaagtatggtgtatttgcgtatactctgcgtataacctaaacttctgtgtactataaaataaaaactatag |
40692913 |
T |
 |
| Q |
113 |
gtatgtataatctaaaagcaaagagtgcttcaacagaaagcatttttcaactgcaagtatggcagtagctacacaagcaagctctctataatgacactac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40692912 |
gtatgtataatctaaaagcaaagagtgcttcaacagaaagcatttttcaactgcaagtatggcagtagctacacaagcaagctctctataatgacactac |
40692813 |
T |
 |
| Q |
213 |
aaagag |
218 |
Q |
| |
|
|||||| |
|
|
| T |
40692812 |
aaagag |
40692807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University