View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10608_low_13 (Length: 253)
Name: NF10608_low_13
Description: NF10608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10608_low_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 12 - 253
Target Start/End: Complemental strand, 46679037 - 46678795
Alignment:
| Q |
12 |
agcaaaggcggctttgtctatagctagtttccacacaggtaattacagtcaccttacaaccttcacttttgctttctcacacttttcccacggaaatttt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46679037 |
agcaaaggcggctttgtctatagctagttcccacacaggtaattacagtcaccttacaaccttcacttttgctttctcacacttttcccacggaaatttt |
46678938 |
T |
 |
| Q |
112 |
actttgagcttgtaa-nnnnnnncattcggccataacaattgtttctatattctgttgggtgaaatctatgtcattatctttataaaatagttatatgtt |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46678937 |
actttgagcttgtaatttttttttattcggccataacaattgtttctatattctgttgggtgaaatctatgtcgttatctttataaaatagttatatgtt |
46678838 |
T |
 |
| Q |
211 |
attnnnnnnnnttgatttggccataacacttgaatagaactcc |
253 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46678837 |
attaaaaagaattgatttggccataacacttgaatagaactcc |
46678795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University