View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10608_low_16 (Length: 243)
Name: NF10608_low_16
Description: NF10608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10608_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 109 - 225
Target Start/End: Complemental strand, 47758708 - 47758592
Alignment:
| Q |
109 |
gtgctgagtaggttaagtatgttgtggagcttgcgcgagccttgggatcaatgccgggagtttatcgggttgatttgctaactaggcaagtcgcatcgcc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47758708 |
gtgctgagtaggttaagtatgttgtggagcttgcgcgagccttgggatcaatgccgggagtttatcgggttgatttgctaactaggcaagtcgcatcgcc |
47758609 |
T |
 |
| Q |
209 |
agatgtagattggagtt |
225 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
47758608 |
agatgtagattggagtt |
47758592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 47758814 - 47758734
Alignment:
| Q |
1 |
tgtcattttctgattgcgcgatacggtactggctgtactcttaaatatgctgatatctagctgattgtgtgggggagctga |
81 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47758814 |
tgtcgttttctgattgcgcgatacggtactggctgtactcttaaatatgctgatatctagctgattgtgtgggggagctga |
47758734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University