View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10608_low_16 (Length: 243)

Name: NF10608_low_16
Description: NF10608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10608_low_16
NF10608_low_16
[»] chr4 (2 HSPs)
chr4 (109-225)||(47758592-47758708)
chr4 (1-81)||(47758734-47758814)


Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 109 - 225
Target Start/End: Complemental strand, 47758708 - 47758592
Alignment:
109 gtgctgagtaggttaagtatgttgtggagcttgcgcgagccttgggatcaatgccgggagtttatcgggttgatttgctaactaggcaagtcgcatcgcc 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47758708 gtgctgagtaggttaagtatgttgtggagcttgcgcgagccttgggatcaatgccgggagtttatcgggttgatttgctaactaggcaagtcgcatcgcc 47758609  T
209 agatgtagattggagtt 225  Q
    |||||||||||||||||    
47758608 agatgtagattggagtt 47758592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 47758814 - 47758734
Alignment:
1 tgtcattttctgattgcgcgatacggtactggctgtactcttaaatatgctgatatctagctgattgtgtgggggagctga 81  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47758814 tgtcgttttctgattgcgcgatacggtactggctgtactcttaaatatgctgatatctagctgattgtgtgggggagctga 47758734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University