View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10608_low_18 (Length: 239)
Name: NF10608_low_18
Description: NF10608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10608_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 9283568 - 9283343
Alignment:
| Q |
1 |
tgacgcgaccaaactccgcggcatcaacccggttcatatggaatgcatatgtagttgtttttgaatcaagcacgaagtcgacgttatcaaattgcatatc |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | | ||||||||||||||||| |
|
|
| T |
9283568 |
tgacgcgaccaaactccgtagcatcaacccggttcatatggaatgcatatatagttgtttttgaatcaagcacgaagttggcattatcaaattgcatatc |
9283469 |
T |
|
| Q |
101 |
actgatccactgaaacacattgaataaacctagcgctttatccacatctacggtgcacagctaagtaacacacaatgttttggac--aacaaaatcaccc |
198 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9283468 |
actgatccactgaaacacatgaaataaacctagcgctttatccacatctacggtgcacaactaagtaacacacaatgttttggacaaaacaaaatcaccc |
9283369 |
T |
|
| Q |
199 |
tcatcatctcacaggcacatacatat |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
9283368 |
tcatcatctcacaggcacatacatat |
9283343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 22 - 107
Target Start/End: Original strand, 40861197 - 40861281
Alignment:
| Q |
22 |
catcaacccggttcatatggaatgcatatgtagttgtttttgaatcaagcacgaagtcgacgttatcaaattgcatatcactgatc |
107 |
Q |
| |
|
||||||| ||| || ||||||| ||||||||||||||||| ||||||||| ||||||| || |||||||||||||||||||||||| |
|
|
| T |
40861197 |
catcaactcgggtcgtatggaaagcatatgtagttgtttt-gaatcaagcccgaagtcaacattatcaaattgcatatcactgatc |
40861281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University