View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10608_low_19 (Length: 238)
Name: NF10608_low_19
Description: NF10608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10608_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 19124976 - 19125193
Alignment:
| Q |
1 |
acgagtaacaatatcaaacggtaagggatcgggaaaggatacaacgacgacggcgggtggaggagggagtccgactgttagtggttcttccggtcgccgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19124976 |
acgagtaacaatatcaaacggtaagggatcgggaaaggatacaacgacgacggtgggtggag---ggagtccgactgttagtggttcttccggtcgccgg |
19125072 |
T |
|
| Q |
101 |
atttctctccggacggtgcttccggtggtgttagtgcttgggatcttgttgccgtttgtttttgttagagttgcgatcttggttcttgaatctgctactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19125073 |
atttctctccggacggtgcttccggtggtgttagtgcttgggatcttgttgccgtttgtttttgttagagttgcgatcttggttcttgaatctgctactt |
19125172 |
T |
|
| Q |
201 |
tttgctcttcattgggtaatt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
19125173 |
tttgctcttcattgggtaatt |
19125193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University