View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10608_low_25 (Length: 227)
Name: NF10608_low_25
Description: NF10608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10608_low_25 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 42411359 - 42411585
Alignment:
| Q |
1 |
caatttagctcattccattcatatgtatatttgtaagtagagaggtgttagcaacagattttttcaacattgtctctattattgagtgcaattcatgtgg |
100 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42411359 |
caatttagcttattccattcatttgtatatttgtacgtagagaggtgttagcaacagattttttcaacattgtctctattattgagtgtaattcatgtgg |
42411458 |
T |
 |
| Q |
101 |
gaacctccaaataggaaatgagacctgcatgattcagtgagccccgcatgaattttatccaattatttctttgtatttatgtatgtatatgtaatcccac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42411459 |
gaacctccaaataggaaatgagacctgcatgattcagtgagccccacatgaattttatccaattatttctttgtatttatgtatgtatatgtaatcccac |
42411558 |
T |
 |
| Q |
201 |
atgattcaccgggtctttctatgtatt |
227 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
42411559 |
atgattcaccgggtctttctatttatt |
42411585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University