View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10608_low_29 (Length: 226)
Name: NF10608_low_29
Description: NF10608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10608_low_29 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 47759119 - 47759344
Alignment:
| Q |
1 |
aatgtagagcttcttgcctttatgattaatagcccaagtttccatagcatcagcagaactgattcgcggtaatctagctttcgtagattcaccaccatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47759119 |
aatgtagagcttcttgcctttatgattaatagcccaagtttccatagcatcagcagaactgattcgcggcaatctagctttcgtagattcaccaccatga |
47759218 |
T |
 |
| Q |
101 |
gcagaaacatcactcaccggatctcctctctcaccttcagataaatcctcagacatatcagcagtagcttctcttctccctctttcacgttccaacctcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47759219 |
gcagaaacatcactcaccggatctcctctctcaccttcagataaatcctcagacatatcagcagtagcttctcttctccctctttcacgttccaacctcc |
47759318 |
T |
 |
| Q |
201 |
ttttcgtcactctctgctcctcctca |
226 |
Q |
| |
|
||||||||||||||||| || ||||| |
|
|
| T |
47759319 |
ttttcgtcactctctgcaccgcctca |
47759344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 45399191 - 45399238
Alignment:
| Q |
166 |
agcttctcttctccctctttcacgttccaacctccttttcgtcactct |
213 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||| |||||||| |
|
|
| T |
45399191 |
agcttctcttctccctctttcatggtccaacctccgttttgtcactct |
45399238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University